We use cookies to make your experience better. To comply with the new e-Privacy directive, we need to ask for your consent to set the cookies. Learn more.
Share this :
Print
Roche Diagnostics Corporation Kappa Dnp Probe (538-567), Asr
Roche Diagnostics Corporation Kappa Dnp Probe (538-567), Asr - ROCHMSD (Additional S&H or Hazmat Fees May Apply)
List Price
$936.79
Your Price
$936.79
HOW MUCH YOU SAVE:
0.00 %
| NETA PART: | ROCHMSD-06543405001 |
| MFG.PART: | 06543405001 |
| UNSPSC: | 41116123 |
| Manufacturer: | Roche Life Science |
Roche Diagnostics Corporation kappa dnp probe (538-567), asr; kappa dnp probe (538-567) is designed to bind to kappa light chain mrna. the probe sequence is complementary to the kappa mrna sequence: 5gccaaaguacaguggaagguggauaacgcc3. - ROCHMSD (Additional S&H or Hazmat Fees May Apply)
| SKU | ROCHMSD-06543405001 |
|---|---|
| Supplier Part Number | 06543405001 |
| UM | UN |
| UNSPSC | 41116123 |
| Manufacturer | Roche Life Science |
| MSDS URL | https://pim-eservices.roche.com/SDS/de/en/06543405001 |
| Refrigerated-Frozen | Refrig +2 to +8C |
| ProductLine | ROCHMSD |
| Qty | 1 |
| MinOrderQty | 1 |
| Depth | 2.2 |
| Height | 2.8 in |
| Weight | 7.00 |
| Lead Time | 5 Business Days |
| Hazardous | N |